Navigation

 


Stages Of Lung Cancer

Overexpression of circulating c-met messenger RNA is significantly correlated with nodal stage and early recurrence in non-small cell lung cancer

Tian-Lu Cheng

Background: The c-met receptor and its ligand hepatocyte growth factor have been shown to be involved in tumor invasiveness and metastasis. Overexpression of c-met has been demonstrated in lung cancer tissues and cell lines, but the expression of c-met in peripheral blood (circulating c-met) has not been addressed. The molecular monitoring of circulating c-met could be helpful for selecting patients for adjuvant therapy.

Objectives: To investigate the expression of circulating c-met in non-small cell lung cancer (NSCLC) patients and to assess its prognostic implications.

Methods: We quantified the levels of c-met messenger RNA (mRNA) in paired tumor and normal lung tissues and their peripheral bloods in 45 patients with NSCLC by real-time polymerase chain reaction (PCR). The expression status of c-met protein in tumor tissues was further evaluated by immunohistochemistry.

Results: e-Met mRNA was significantly higher by 1.5 to 11 times in 34 of 45 tumor tissues (75.5%) than it was in their normal counterparts by real-time PCR. A comparison of this assay to immunohistochemistry suggested that real-time PCR was more sensitive than immunohistochemistry (27 of 45 tumor tissues, 60.0%) for the detection of c-met (p = 0.016). Of these patients with overexpression of c-met in tumors, 67.6% (23 of 34 patients) expressed higher amounts of circulating c-met by 1.4 to 8 times that of the normal control subjects. In addition, overexpression of circulating c-met was significantly correlated with nodal (N) stage (p = 0.011), but weakly correlated with tumor (T) stage (p = 0.056) and overall stages (p = 0.054) in patients with NSCLC. However, no correlations were found among circulating c-met and other factors such as age, gender, and pathologic types. Moreover, by univariate analysis, circulating c-met overexpression and pathologic stages (including T and N stages) were the most important factors correlated with early recurrence (p < 0.05). Only the circulating c-met remained as an independent predictor of early recurrence (hazard ratio, 3.94; 95% confidence interval, 1.17 to 13.33; p = 0.027) after Cox regression multivariate analysis.

Conclusions: Overexpression of circulating c-met is significantly correlated with the N stage and early recurrence. Moreover, early recurrence is frequently noted in patients with overexpression of circulating c-met, indicating that circulating c-met is an independent negative prognostic indicator in NSCLC.

Key words: c-met; circulating c-met; non-small cell lung cancer; real-time polymerase chain reaction

Abbreviations: CI = confidence interval; HR = hazard ratio; IMH = immunohistochemical staining; mRNA = messenger RNA; N = nodal; NSCLC = non-small cell lung cancer; PCR = polymerase chain reaction; RT = reverse transcriptase; T = tumor

**********

Surgery remains the best potentially curative therapy for patients with non-small cell lung cancer (NSCLC). Despite complete resection, the 5-year survival rate is still < 15%, most likely because some metastases are undetected at the time of surgery. In the past decade, many investigators have used immunohistochemistry and Western blot analysis to detect metastases in bone marrow and lymph nodes from patients with NSCLC. (1-4) However, most of these are mainly qualitative, or at best semi-quantitative. Reverse transcriptase (RT)-polymerase chain reaction (PCR)-based techniques have been shown to be more sensitive than immunohistochemistry for the detection of metastases in patients with breast, gastric, colorectal, and renal cell carcinoma. (5-10)

The formation of metastatic lesions requires that tumor cells circulate throughout the body before they reach to the target organ. The identification of epithelial cells in bone marrow or lymph nodes encouraged the detection of epithelial messenger RNA (mRNA) in peripheral blood by RT-PCR. (11-12) Therefore, the molecular monitoring of circulating tumor cells in cancer patients by real-time RT-PCR could be an attractive method for the selection of high-risk patients who would benefit from adjuvant therapy. (11-14) The proto-oncogene c-met and its ligand hepatocyte growth factor were shown to be involved in angiogenesis, growth, and invasion. (15,16) Significant overexpression of c-met mRNA has been shown in the tissues and cell lines of NSCLC (17-20) and small cell lung cancer. (21) However, in these reports, all expression of c-met was evaluated in either cancer tissues or cell lines by Western blot analysis and/or immunohistochemistry. This will limit the clinical use because the methods are not sensitive enough compared to real-time PCR. To our knowledge, no report has been published regarding the expression of c-met in peripheral blood (circulating c-met) and its prognostic significance in patients with NSCLC. Therefore, this study was performed to determine the levels of c-met mRNA in tumor tissues and peripheral blood from patients with NSCLC by real-time RT-PCR and immunohistochemistry, and to elucidate the potential role of circulating c-met as a molecular marker in the prognostic prediction of NSCLC.

MATERIALS AND METHODS

Patients and Specimens

Informed written consent was obtained from each subject, and the study was approved by the Institutional Review Board of Kaohsiung Medical University. Lung cancer tissues and adjacent normal lung tissues were obtained surgically from patients with pathologically proven NSCLC at the Department of Surgery, Kaohsiung Medical University Hospital. Tumors were classified by morphologic and immunohistochemical characteristics. Surgical-pathologic staging was used to determine precisely characteristics of the primary tumor (T), nodal (N), and metastasis stages according to the TNM International Staging System for Lung Cancer. (22) No tumors were included if they contained elements of small cell carcinoma. Three patients were excluded from analysis because of unclear or mixed histology (eg, adenosquamous). Patients with surgical-related mortality were also excluded (n = 2). Forty-five patients were enrolled in study. Before the surgical procedure, 5 mL of peripheral blood was drawn from NSCLC patients into test tubes containing anticoagulant sodium citrate. Blood sampling was also performed in 20 normal control subjects and 31 patients with benign lung diseases (COPD, asthma, and bronchiectasis). Tissue samples were collected immediately after surgical resection, and frozen instantly in liquid nitrogen, after which the RNA of whole blood was immediately extracted as a template for complementary DNA synthesis, and then the tissue samples and complementary DNA of blood were stored at-80[degrees]C until analysis.

Total RNA Isolation and First Complementary DNA Synthesis

Total RNA from tissue and blood of NSCLC patients and normal control subjects was extracted by the acid guanidinium thiocyanate-phenol/chloroform method (23) and used as a template for complementary DNA synthesis. First-strand complementary DNA was synthesized from total RNA (2 [micro]g) with a commercially available kit (Advantage RT-for-PCR kit; Clontech; Palo Alto, CA) as described by the manufacturer. The reaction was performed at 42[degrees]C for 2 h and stopped by adding 2 [micro]L of 0.2 mol/L ethylenediamine tetra-acetic acid.

Real-time PCR

PCR was carried out at a final concentration of 1 x PCR buffer, 50 [micro]mol/L deoxynucleoside triphosphate, as well as 2.5 U of Tag DNA polymerase (Promega Corporation; Madison, WI). Each reaction contained 1 [micro]L (100 nmol/L final concentration) of forward and reverse primer. For c-met, the forward primer was 5' TGACGTAAACACCTTTGA3', while the reverse primer was 5'ATTTCGGCTTTACGCGGGTA3'. A 134 base-pair fragment was predicted from this primer pair. The forward primer for [beta]-actin was 5'CCTGACGGCCAGGTCATCA3', while the reverse primer was 5'TGGACATGCGGTTGTGTCAC3', and a 167 base-pair fragment was predicted. A negative control was assembled using the same concentrations of reagents as described above. Samples were amplified in a thermocycler (Rotor-Gene 2000; Corbett Research; Sydney, Australia) for 40 cycles of 15 s at 95[degrees]C and 1 min at 60[degrees]C. Estimation of c-met and [beta]-actin mRNA levels was carried out according to the instruction manual of the Rotor-Gene 2000 system. The quantity of c-met mRNA was normalized to [beta]-actin. While expression ratio of c-met mRNA in tumors was defined as the corrected density in tumor tissues divided by that of paired normal lung tissues, the expression ratio of circulating c-met mRNA was defined as corrected density of blood in NSCLC patients and subjects with benign lung diseases divided by the mean value (defined as 1.0) of 20 normal control subjects. Overexpression was considered if the expression ratio was > 1. These results were obtained from triplicate assays.

Immunohistochemistry

All tissue samples were dissected into 1-cm pieces immediately after surgical removal, frozen in liquid nitrogen, and then stored at -80[degrees]C until analysis. Tissue samples were mounted (Tissue-Tek OCT compound; Ames Division, Miles Laboratory; Elkhart, IN), and 4- to 6-[micro]m sections of each specimen were cut, air dried, and fixed in acetone for 10 min. Immunologic detection was performed using anti-c-met polyclonal antibody (Santa Cruz Biotechnology; Santa Cruz, CA), which recognized a C-terminus of c-met peptide (C-28). The binding of the antibody was visualized by the avidin-biotin-complex-peroxidase technique, using a sensitive immunoperoxidase system (Vectastain Elite; Vector Laboratories; Burlingame, CA). The tumors were considered as positive if [greater than or equal to] 10% of neoplastic cells showed distinct plasma membrane staining (Fig 1).

[FIGURE 1 OMITTED]

Statistical Analysis

All data were analyzed using statistical software (SPSS Version 12; SPSS; Chicago, IL; and SAS 8.1; SAS Institute; Cary, NC). Sensitivity and specificity of circulating c-met as a molecular marker were determined. The associations between the expression of c-met mRNA and clinicopathologic features were analyzed by the Student t test and the [chi square] test. If the expected numbers < 5 were > 25%, a Fisher Exact Test was used instead. The relationships between the cumulative probability of early recurrence and clinical variables, including the expression of c-met, were determined by Cox regression univariate analyses. (24) Those variables in early recurrence (disease-free survival) were further included in multivariate Cox regression models. The validation of models was performed by omnibus tests using SPSS version 12 (SPSS). A probability of < 0.05 was accepted as significant.

RESULTS

Clinicopathologic Features

Among these patients, 27 were men and 18 were women (mean age, 57.0 years; range, 41 to 80 years). The patients with adenocarcinoma were 2 years younger than those with squamous cell carcinoma (p = 0.99). Thirty patients had adenocarcinoma, and 15 patients had squamous cell carcinomas. With regard to T stage, T1 was subsequently diagnosed in 17 patients, T2 was diagnosed in 19 patients, and T3 was diagnosed in 9 patients. For N stage, 11 patients (24.4%) had NO, 26 patients (57.8%) had N1, and 8 patients (17.8%) had N2 disease. Regarding overall stage, 11 patients (24.4%) had stage I, 9.5 patients (55.5%) had stage II, and 9 patients (20%) had stage IIIa disease (Table 1).

Overexpression of c-Met mRNA and Protein Was Found in Tumor Tissues

Among the 45 paired surgical specimens, c-met mRNA was overexpressed in 75.5% (34 of 45 cases) of the tumor tissues in comparison with their normal counterparts. The expression ratios detected in tumor tissues were up to 11 times that of the control subjects. For comparison of the results of real-time PCR analysis, immunohistochemical staining (IMH) for c-met was performed in tumor tissues of 45 NSCLC patients. The positive rate was 60% (27 of 45 cases). The results revealed that real-time PCR was more sensitive than immunohistochemistry (p = 0.016) [Table 2; Fig 1]. In addition, 24 of 30 adenocarcinomas (80%) had c-met overexpression, as compared with 10 of 15 squamous cell carcinomas (66.7%; p = 0.67). Similarly, 20 of 30 adenocarcinomas (66.7%) had c-met protein expression, as compared with 7 of 15 squamous cell carcinomas (46.7%) by immunohistochemistry (p = 0.36), indicating that there was no significant difference in c-met expression between adenocarcinoma and squamous cell carcinoma in NSCLC.

Overexpression of c-Met in Tumor Tissues Tended To Be Associated With Overexpression of Circulating c-Met

Of the 11 patients without overexpression of c-met in tumor tissues, none had overexpression of circulating c-met. However, of 34 patients with c-met mRNA overexpression in tumor tissues, 67.6% (23 of 34 patients) had overexpression of circulating c-met mRNA. Expression ratios of circulating c-met mRNA ranged from 1.5 to 8 times (Table 1). The overexpression of c-met mRNA in tumor tissues tended to be associated with the detection of circulating c-met of NSCLC patients. Meanwhile, of those 31 patients with benign lung diseases, in only 1 patient was circulating c-met overexpressed. Thus, as a molecular marker of NSCLC, sensitivity and specificity of circulating c-met were 51.1% (23 of 45 patients) and 96.8% (30 of 31 patients), respectively. Moreover, the positive predictive rate was 95.8% (23 of 9.4 patients), negative predictive rate was 57.7% (30 of 52 patients), and accuracy was 69.7% (53 of 76 patients).

Overexpression of Circulating c-Met Was Correlated With N Stage

We correlated the overexpression of circulating c-met mRNA with pathologic stages in those 34 patients who had overexpression of c-met mRNA in tumor tissues. Overexpression of circulating c-met mRNA was detected in 33% (three of nine patients) with stage T1. In addition, overexpression of circulating c-met mRNA was found in 76.5% (13 of 17 patients) with stage T2 and in 87.5% (7 of 8 patients) with stage T3. Moreover, the overexpression of circulating c-met mRNA was 28.6% (2 of 7 patients) with stage N0, 70% (14 of 20 patients) with stage N1, and 100% (7 of 7 patients) with stage N2. For overall staging, overexpression of circulating c-met mRNA was found in 28.6% (2 of 7 patients) with stage I, 73.7% (14 of 19 patients) with stage II, and 87.5% (7 of 8 patients) with stage IIIa, respectively (Table 3). Overexpression of circulating c-met mRNA was weakly correlated with T stage (p = 0.056) and overall (p = 0.054) stages. However, there was significant correlation between circulating c-met and N stage (p = 0.011). In contrast, no statistical difference was found between circulating e-met overexpression and other clinicopathologic features such as age (p = 0.93), gender (p = 0.50), or pathologic types (p = 0.32) [Table 3].

Overexpression of Circulating c-Met Was Correlated With Early Recurrence

During the mean follow-up period of 23 months (up to 91 months), tumors recurred in 22 patients (14 with adenocarcinoma and 8 with squamous cell carcinoma); 8 of these patients died of cancer thereafter (5 with adenocarcinoma and 3 with squamous cell carcinoma). For pathologic staging, the recurrence rate was 9% (1 of 11 patients) in stage I, 56% (14 of 25 patients) in stage II, and 77.8% (7 of 9 patients) in stage IIIa, respectively. Whereas, the 78.3% (18 of 23 patients) with circulating c-met overexpression had recurrence of the disease, and 8 of these died subsequently, the 18.2% (4 of 22 patients) without circulating e-met overexpression who had cancer recurrence have not died. By Cox regression univariate analyses, significant predictors of early recurrence were pathologic stages including T stage (p = 0.005), N stage (p = 0.013), overall stage (hazard ratio [HR], 2.43; 95% confidence interval [CI], 1.25 to 4.73;p = 0.009), and circulating c-met overexpression (HR, 5.40; 95% CI, 1.81 to 16.09; p = 0.002). However, there was no difference in early recurrence between patients with adenocarcinoma and those with squamous cell carcinoma. Also, the difference in early recurrence for other variables such as age and gender did not reach statistical significance (Table 4). The circulating c-met remained as an independent prognostic factor in tumor recurrence (HR, 3.94; 95% CI, 1.17 to 13.33; p = 0.027) in NSCLC using the Cox model for multivariate analysis. However, for pathologic stages, the difference in tumor recurrence (HR, 2.59; 95% CI, 0.27 to 25.06; p = 0.41) lost statistical significance in the multivariate analysis (Table 5).

DISCUSSION

In this study, we first reported that the amount of c-met mRNA could be quantified in clinical NSCLC tissues and peripheral blood using real-time PCR analysis. Our results showed that the expression of c-met in tumor tissues is associated with the expression of circulating c-met. In addition, c-met mRNA either in tumors or in peripheral blood is not differentially expressed in the adenocarcinoma and squamous cell subtypes of NSCLC. These results are consistent with most other reports except for one, which demonstrated low c-met mRNA expression in a panel of squamous cell lines, in contrast to high c-met expression in adenocarcinomas. (25) Moreover, our results demonstrated that the overexpression of circulating c-met is significantly correlated with the N stage, implying that NSCLC patients with higher detectable circulating c-met have a tendency to be more advanced in disease. However, the weak correlation between circulating c-met and T stage and overall stages is less surprising. While it is well known that T status in TNM staging system has been thought to reflect primary tumor size, in contrast, the presence of submicroscopic metastases in lymph nodes has been referred to as occult micrometastases. It is reasonable to assume that circulating c-met would correlate more closely with N status than T status. In addition, pathologic stages and circulating c-met are the two most reliable determinants of early postoperative recurrence of NSCLC by univariate analysis, but only the circulating c-met remained as an independent negative prognostic factor for tumor recurrence after multivariate analysis, suggesting that circulating e-met, in addition to pathologic staging, could accurately predict the risk of tumor recurrence and metastatic spread.

Several techniques have been applied to investigate the expression status of oncogenes or tumor suppressor genes in tumor tissues. Immunohistochemistry is a frequently used method. However, a great variation in the interpretation of results has been noted. The variation could result from the different materials, diagnostic criteria, or subjective biases. This is the reason why some of the results using immunohistochemistry were unable to provide a consensus. (26) In this study, we used real-time PCR analysis to evaluate the expression of mRNA transcripts encoding c-met gene. Our results revealed that c-met overexpression was found in 75.5% (34 of 45 tumor tissues) by real-time PCR, as compared with 60.0% (27 of 45 tumor tissues) by immunohistochemistry. The findings further confirmed that real-time PCR provided a satisfactory result with a high detection rate and low variability in evaluating gene expression in both cells and tissues. Moreover, this method was more sensitive than immunohistochemistry, consistent with the results of other reports. (12)

In addition, most studies (1-7) are directed toward the identification of cancer cells in tumor tissues, lymph nodes, and bone marrow. Detection of circulating cancer cells may allow selection of a subset of patients who would benefit substantially from adjuvant therapies. So far, few studies have demonstrated that real-time PCR has been successfully applied in the detection of disseminated tumor cells in peripheral blood from patients with colorectal and prostate cancers. (11,13,14) Our results demonstrated that this technique could be utilized to detect the tumor cells in peripheral blood of NSCLC patients. The sensitivity and specificity of circulating c-met were 51.1% and 96.8%, respectively. Based on the observation, identification of patients at high risk for metastatic disease after curative resection of NSCLC might be improved by analyzing peripheral blood samples.

To date, a panel of biomarkers has been implicated in prognosis of NSCLC including k-ras mutation, p53, erbB2/Neu, Bcl2, and specific mucin genes. (27-31) However, the results are controversial. Takanami et al (18) have shown the association of c-met with poor survival in resectable NSCLC. In our study, 78.3% (18 of 23 NSCLC patients) with circulating c-met overexpression were found to have postoperative relapse. Of these patients, eight died subsequently. Since the follow-up period in our study is not sufficiently long and the sample size is still limited, producing HRs with wide 95% CIs, collecting more samples and an investigation of the association between circulating c-met and 5-year survival rate are now underway. However, our present findings, similar to other reports, (17,18) have confirmed these observations and specified the association of early recurrence with circulating c-met overexpression. Nevertheless, whether the levels of circulating c-met will elevate in patients who have early recurrence of disease or the changes of circulating c-met expression will correlate with the postoperative courses in NSCLC patients are questions not fully answered and these require further study.

Moreover, the signal transduction pathways downstream from the receptor activation are largely unknown, and the mechanism underlying the close relationship between c-met expression and tumor progression requires further investigation. Several studies (32,33) have addressed the mechanism whereby hepatocyte growth factor/c-met activates Ras protein, subsequently enhancing Ras-mediated tumorigenesis and metastasis. Thus, targeting c-met receptor may be an effective novel strategy to treat NSCLC patients. Currently, c-Met inhibitors such as NK4, K252a, and PHA-665752 are in development. (34-36) It is to be hoped that this will give us much more choice in conjunction with standard chemotherapy for the treatment of NSCLC in the near future.

In conclusion, our study demonstrated that over-expression of circulating c-met is significantly associated with N stage and early recurrence in NSCLC. Patients with circulating c-met overexpression are at high risk of postoperative disease recurrence, indicating that circulating c-met is an independent poor prognostic factor in NSCLC. The real-time PCR assay for circulating c-met mRNA may identify a group of NSCLC patients who have a poor prognosis and may benefit from adjuvant therapies.

ACKNOWLEDGMENT: The authors are grateful to Ms. Yi-Fang Chen for technical assistance and Dr. Hung-Yi Chung from the Statistic Consulting Room, Department of Clinical Research, Kaohsiung Medical University for statistical assistance.

REFERENCES

(1) Pantel K, Izbicki JR, Angstwurm M, et al. Immunocytological detection of bone marrow micrometastasis in operable non-small cell lung cancer. Cancer Res 1993; 53:1027-1031

(2) Passlick B, Izbicki JR, Kubuschok B, et al. Immunohistochemical assessment of individual tumor cells in lymph nodes of patients with non-small-cell lung cancer. J Clin Oncol 1994; 12:1827-1832

(3) Pantel K, Izbicki J, Passlick B, et al. Frequency and prognostic significance of isolated tumour cells in bone marrow of patients with non-small-cell lung cancer without overt metastases. Lancet 1996; 347:649-653

(4) Maruyama R, Sugio K, Mitsudomi T, et al. Relationship between early recurrence and micrometastases in the lymph nodes of patients with stage I non-small-cell lung cancer. J Thorac Cardiovasc Surg 1997; 114:535-543

(5) Mori M, Mimori K, Inoue H, et al. Detection of cancer micrometastases in lymph nodes by reverse transcriptase-polymerase chain reaction. Cancer Res 1995; 55:3417-3420

(6) Noguchi S, Aihara T, Motomura K, et al. Detection of breast cancer micrometastases in axillary lymph nodes by means of reverse transcriptase-polymerase chain reaction: comparison between MUC1 mRNA and keratin 19 mRNA amplification. Am J Pathol 1996; 148:649-656

(7) Noguchi S, Aihara T, Nakamori S, et al. The detection of breast carcinoma micrometastases in axillary lymph nodes by means of reverse transcriptase-polymerase chain reaction. Cancer 1994; 74:1595-1600

(8) Merkelbach-Bruse S, Wardelmann E, Behrens P, et al. Current diagnostic methods of HER-2/neu detection in breast cancer with special regard to real-time PCR. Am J Surg Pathol 2003; 27:1565-1570

(9) Sakakura C, Takemura M, Hagiwara A, et al. Overexpression of dopa decarboxylase in peritoneal dissemination of gastric cancer and its potential as a novel marker for the detection of peritoneal micrometastases with real-time RT-PCR. Br J Cancer 2004; 90:665-671

(10) Pantel K, Von Knebel Doeberitz M. Detection and clinical relevance of micrometastatic cancer cells. Curr Opin Oncol 2000; 12:95-101

(11) Schuster R, Max N, Mann B, et al. Quantitative real-time RT-PCR for detection of disseminated tumor cells in peripheral blood of patients with colorectal cancer using different mRNA markers. Int J Cancer 2004; 108:219-227

(12) Thomasson M, Hedman H, Guo D, et al. LRIG1 and epidermal growth factor receptor in renal cell carcinoma: a quantitative RT-PCR and immunohistochemical analysis. Br J Cancer 2003; 89:1285-1289

(13) Guller U, Zajac P, Schnider A, et al. Disseminated single tumor cells as detected by real-time quantitative polymerase chain reaction represent a prognostic factor in patients undergoing surgery for colorectal cancer. Ann Surg 2002; 236:768-775

(14) Ady N, Morat L, Fizazi K, et al. Detection of HER-2/neupositive circulating epithelial cells in prostate cancer patients. Br J Cancer 2004, 90:443-448

(15) Cooper CS, Park M, Blair DG, et al. Molecular cloning of a new transforming gene from a chemically transformed human cell line. Nature 1984; 311:29-33

(16) van der Voort R, Taher TE, Derksen PW, et al. The hepatocyte growth factor/Met pathway in development, tumorigenesis, and B-cell differentiation. Adv Cancer Res 2000; 79:39-90

(17) Ichimura E, Maeshima A, Nakajima T, et al. Expression of c-met/HGF receptor in human non-small cell lung carcinomas in vitro and in vivo and its prognostic significance. Jpn J Cancer Res 1996; 87:1063-1069

(18) Takanami I, Tanana F, Hashizume T, et al. Hepatocyte growth factor and c-Met/hepatocyte growth factor receptor in pulmonary adenocarcinomas: an evaluation of their expression as prognostic markers. Oncology 1996; 53:392-397

(19) McDoniels-Silvers AL, Nimri CF, Stoner GD, et al. Differential gene expression in human lung adenocarcinomas and squamous cell carcinomas. Clin Cancer Res 2002; 8:1127-1138

(20) Olivero M, Rizzo M, Madeddu R, et al. Overexpression and activation of hepatocyte growth factor/scatter factor in human non-small-cell lung carcinomas. Br J Cancer 1996; 74:1862-1868

(21) Maulik G, Kijima T, Ma PC, et al. Modulation of the c-Met/hepatocyte growth factor pathway in small cell lung cancer. Clin Cancer Res 2002; 8:620-627

(22) Mountain CF. Revisions in the international system for staging lung cancer. Chest 1997; 111:1710-1717

(23) Chomezynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156-159

(24) Cox D. Regression models and life tables (with discussion). JR Star Soc 1972; 34:187-200

(25) Tsao MS, Liu N, Chen JR, et al. Differential expression of Met/hepatocyte growth factor receptor in subtypes of non-small cell lung cancers. Lung Cancer 1998; 20:1-16

(26) Carbone DP, Mitsudomi T, Chiba I, et al. p53 immunostaining positivity is associated with reduced survival and is imperfectly correlated with gene mutations in resected non-small cell lung cancer: a preliminary report of LCSG 871. Chest 1994; 106:377S-381S

(27) Slebos RJ, Kibbelaar RE, Dalesio O, et al. K-ras oncogene activation as a prognostic marker in adenocarcinoma of the lung. N Engl J Med 1990; 323:561-565

(28) Lee JS, Yoon A, Kalapurakal SK, et al. Expression of p53 oncoprotein in non-small-cell lung cancer: a favorable prognostic factor. J Clin Oncol 1995; 13:1893-1903

(29) Pezzella F, Turley H, Kuzu I, et al. bcl-2 protein in non-small-cell lung carcinoma. N Engl J Med 1993; 329:690-694

(30) Yu CJ, Shun CT, Yang PC, et al. Sialomucin expression is associated with erbB-2 oncoprotein overexpression, early recurrence, and cancer death in non-small-cell lung cancer. Am J Respir Crit Care Med 1997; 155:1419-1427

(31) Pastorino U, Andreola S, Tagliabue E, et al. Immunocytochemical markers in stage I lung cancer: relevance to prognosis. J Clin Oncol 1997; 15:2858-2865

(32) Graziani A, Gramaglia D, dalla Zonca P, et al. Hepatocyte growth factor/scatter factor stimulates the Ras-guanine nucleotide exchanger. J Biol Chem 1993; 268:9165-9168

(33) Webb CP, Taylor GA, Jeffers M, et al. Evidence for a role of Met-HGF/SF during Ras-mediated tumorigenesis/metastasis. Oncogene 1998; 17:2019-2025

(34) Kuba K, Matsumoto K, Date K, et al. HGF/NK4, a four-kringle antagonist of hepatocyte growth factor, is an angiogenesis inhibitor that suppresses tumor growth and metastasis in mice. Cancer Res 2000; 60:6737-6743

(35) Morotti A, Mila S, Accornero P, et al. K252a inhibits the oncogenic properties of Met, the HGF receptor. Oncogene 2002; 21:4885-4893

(36) Christensen JG, Schreck R, Burrows J, et al. A selective small molecule inhibitor of c-Met kinase inhibits c-Met-dependent phenotypes in vitro and exhibits cytoreductive antitumor activity in vivo. Cancer Res 2003; 63:7345-7355

* From the MedicoGenomic Research Center (Ms. Chang), School of Biomedical Science and Environmental Biology (Dr. T-L Cheng), Department of Surgery (Drs. Kao and Y-J Cheng), and Department of Internal Medicine (Dr. Sheu) Kaohsiung Medical University, Kaohsiung. Sung-Hua Gene Co. Ltd. (Mr. Huang), Kaohsiung, Taiwan; and the Department 'of Internal Medicine (Dr. Chong), Kaohsiung Municipal Hsaio-Kang Hospital, Kaohsiung Medical University, Kaohsiung Taiwan. This study was supported by academic-industrial collaboration funds from Sung-Hua Gene Co., Ltd.

Mr. Sung-Yu Huang serves on the advisory board for Sung-Hua Gene Co., Ltd. without compensation.

Manuscript received July 1, 2004; revision accepted February 23, 2005.

Reproduction of this article is prohibited without written permission from the American College of Chest Physicians (www.chestjournal. org/misc/reprints.shtml).

Correspondence to: Inn-Wen Chong, MD, FCCP, Department of Internal Medicine, Kaohsiung Medical University, 100 Shih-Chuan First Rd, Kaohsiung, 807 Taiwan; e-mail: chong@cc.kmu. edu.tw

Table 1--Clinicopathologic Features and Expression of c-Met Gene in
NSCLC *

Patient No.    Gender    Age, yr    Stage    T Stage    N Stage

 1             Female      57        Ia         1          0
 2             Male        42        IIb        2          1
 3             Male        73        IIa        2          1
 4             Female      44        IIb        2          1
 5             Male        69        Ia         2          0
 6             Male        76        Ib         2          0
 7             Male        80        IIb        2          1
 8             Male        46        IIa        1          1
 9             Male        64        IIa        2          1
10             Male        55        IIa        2          1
11             Female      77        IIb        2          1
12             Male        42        IIIa       3          2
13             Female      47        IIb        2          1
14             Male        60        IIb        2          1
15             Male        51        Ia         1          0
16             Female      67        Ia         1          0
17             Male        64        IIb        2          1
18             Female      43        Ib         1          0
19             Male        42        Ia         1          0
20             Male        50        IIa        1          1
21             Female      55        IIIa       3          2
22             Female      60        IIIa       3          2
23             Male        46        IIa        1          1
24             Female      51        IIb        1          1
25             Male        64        IIIa       3          2
26             Male        70        IIa        1          1
27             Female      60        IIa        2          1
28             Female      58        Ib         1          0
29             Male        57        IIa        2          1
30             Male        51        IIb        2          1
31             Male        47        IIb        2          1
32             Male        62        IIIa       3          2
33             Female      43        IIb        1          1
34             Male        51        Ib         1          0
35             Female      57        IIb        2          1
36             Female      65        IIIa       3          2
37             Female      62        IIIa       3          1
38             Male        54        IIa        2          1
39             Male        41        Ia         1          0
40             Female      60        IIIa       3          2
41             Female      51        Ib         1          0
42             Male        46        IIa        1          1
43             Male        74        IIb        2          1
44             Female      70        IIb        1          1
45             Male        64        IIIa       3          2

                                                Expression Ratio
                                                ([double dagger])
                                                 (Real-time PCR)
               Patbologic
Patient No.       Type       IMII ([dagger])     Tumors    Blood

 1                 AC               +             2.5 X    0.9 X
 2                 AC               +             2.6 X    2.0 X
 3                 AC               +             5.0 X    1.0 X
 4                 AC               +            11.0 X    4.2 X
 5                 SC               -             0.9 X    0.8 X
 6                 AC               +             3.5 X    0.9 X
 7                 AC               +             5.0 X    4.1 X
 8                 AC               +             4.0 X    0.9 X
 9                 AC               +             4.0 X    1.6 X
10                 AC               +             4.0 X    1.7 x
11                 SC               +             6.0 x    1.9 x
12                 AC               +             3.6 X    2.2 X
13                 AC               +             5.7 X    3.9 X
14                 SC               +             3.0 X    1.5 X
15                 AC               -             0.8 X    0.9 X
16                 AC               -             0.9 X    0.9 X
17                 SC               -             2.0 X    0.9 X
18                 AC               -             4.0 x    1.0 X
19                 AC               -             1.5 X    0.8 x
20                 AC               +             2.0 X    1.5 x
21                 AC               +             9.5 X    8.0 X
22                 SC               +             3.5 X    3.0 X
23                 SC               -             0.9 x    0.9 X
24                 SC               -             1.0 X    0.9 X
25                 AC               +             6.0 X    4.3 X
26                 AC               -             0.8 x    0.8 X
27                 AC               -             0.9 X    0.9 X
28                 SC               +             3.5 X    2.5 X
29                 AC               +             2.5 X    1.5 X
30                 AC               +             4.5 X    2.7 X
31                 SC               +             2.1 X    1.4 X
32                 AC               +             3.0 X    2.3 X
33                 SC               -             1.0 x    0.9 X
34                 AC               -             1.5 X    0.9 X
35                 AC               +             2.7 x    1.9 x
36                 AC               +             6.5 X    4.0 X
37                 AC               +             2.5 X    1.0 X
38                 SC               -             2.0 X    0.9 X
39                 AC               -             0.9 X    0.8 X
40                 SC               +             3.5 x    2.0 X
41                 SC               -             1.5 x    1.5 X
42                 AC               -             2.0 X    0.9 X
43                 SC               +             2.0 x    1.6 X
44                 AC               -             0.9 X    0.9 X
45                 SC               -             0.8 X    0.9 X

* AC = adenocarcinoma; SC =squamous cell carcinoma.

([dagger]) The tumors were considered positive if [greater than or equal
to] 10% of neoplastic cells showed distinct membrane staining.

([double dagger]) Densitometric quantification of c-met mRNA was
normalized to [beta]-actin, and the corrected density in tumors or
blood was further divided by that of normal control and presented as
expression ratio. Overexpression was defined if expression ratio
was > 1.

Table 2--Correlations of the Pathologic Stages and
Overexpression of c-Met in Tumor Tissues in 45
NSCLC Patients *

                             c-Met Overespression

Variables          IMH        Real-time PCR         p Value

T stage
  T1          23.5 (4/17)      52.9 (9/17)
  T2          78.9 (15/19)     89.5 (17/19)
  T3          88.9 (8/9)       88.9 (8/9)
N stage
  N0          27.3 (3/11)      63.6 (7/11)
  N1          65.4 (17/26)     76.9 (20/26)
  N2          87.5 (7/8)       87.5 (7/8)
Stage
  I (a+b)     27.3 (3/11)      63.6 (7/11)
  11 (a+b)     64 (16/25)      76 (19/25)
  IIIa        88.9 (8/9)       88.9 (8/9)
Total         60.0 (27/45)     75.5 (34/45)     0.016 ([dagger])

* Data are presented as % (No./total patients.)

([dagger]) McNemar test.

Table 3--Comparison of Clinicopathologic Parameters
in 34 Patients With Expression of e-Met, Based on the
Detection of Circulating c-met Overexpression *

                                Circulating c-Met Overexpression

                                Detectable          Undetectable
        Variables                (n = 23)             (n = 11)

Age, yr                      57.5 [+ or -] 2.2    55.8 [+ or -] 3.5
Male gender                  13                    8
Female gender                10                    3
Pathologic types
  Adenocarcinoma             15                    9
  Squamous cell carcinoma     8                    2
T stage
  T1                          3                    6
  T2                         13                    4
  T3                          7                    1
N stage
  N0                          2                    5
  N1                         14                    6
  N2                          7                    0
Stage
  I (a+b)                     2                    5
  II (a+b)                   14                    5
  IIIa                        7                    1

        Variables                    p Value

Age, yr                      0.93 ([dagger])
Male gender                  0.50 ([double dagger])
Female gender
Pathologic types             0.32 ([double dagger])
  Adenocarcinoma
  Squamous cell carcinoma
T stage                      0.056 ([section])
  T1
  T2
  T3
N stage                      0.011 ([section])
  N0
  N1
  N2
Stage                        0.054 ([section])
  I (a+b)
  II (a+b)
  IIIa

* Data are presented as mean [+ or -] SE or No.

([dagger]) Student t test.

([double dagger]) [chi square] test.

([section]) Fisher Exact Test.

Table 4--Cox Regression Univariate Analysis of the
Effect of Variables on Early Recurrence in NSCLC

                 Variables                        HR (95% CI)

Male/female gender                             0.71 (0.31-1.64)
[less than or equal to] 60/> 60 years of age   0.86 (0.37-2.04)
T stage                                        2.34 (1.30-4.23)
N stage                                        2.37 (1.20-4.70)
Stage                                          2.43 (1.25-4.73)
Squamous cell/adenocarcinoma                   1.08 (0.42-2.77)
Circulating c-met                              5.40 (1.81-16.09)

                 Variables                     p Value

Male/female gender                               0.42
[less than or equal to] 60/> 60 years of age     0.74
T stage                                          0.005
N stage                                          0.013
Stage                                            0.009
Squamous cell/adenocarcinoma                     0.87
Circulating c-met                                0.002

Table 5--Cox Regression Multivariate Analysis of the
Influences of Variables on Early Recurrence in NSCLC

Prognostic Variables      HR (95% CI)        p Value

Gender                  0.85 (0.34-2.10)      0.72
Age                     0.82 (0.33-2.06)      0.67
Stage                   2.59 (0.27-25.06)     0.41
Circulating c-met       3.94 (1.17-13.33)     0.027

COPYRIGHT 2005 American College of Chest Physicians
COPYRIGHT 2005 Gale Group




Lung Cancer
Prostate Cancer
Ovarian Cancer
Colon Cancer
Thyroid Cancer
Cervical Cancer
Liver Cancer
Testicular Cancer
Pancreatic Cancer
Stomach Cancer
Bone Cancer
Throat Cancer
National Cancer Institute
Bladder Cancer
Cancer Treatment Centers Of America
Cancer Symptoms
Uterine Cancer
Brain Cancer
Kidney Cancer
American Cancer Association
Mouth Cancer
Cancer Research
Types Of Cancer
Pancreas Cancer
Signs Of Cancer
Tongue Cancer
Lymph Node Cancer
Cancer Society
Fox Chase Cancer Center
Cancer Horoscope
Cancer Cure
Esophageal Cancer
Colorectal Cancer
Rectal Cancer
Esophagus Cancer
Zodiac Sign Cancer
Cervix Cancer
Endometrial Cancer
Stages Of Cancer

Copyright © 2005 Drug-Store.co.uk All Rights Reserved.